eDNA monitoring in Sydney Harbour

Unlocking Nature’s Secrets with a Drop of Water: Introducing eDNA

Nicole McMahon, Earth to Sea Guardians

There’s a quiet revolution happening in the way we understand marine life, and it starts with something as simple as a splash of seawater.

Dr Joseph DiBattista and his team are leading the charge in a groundbreaking new field called environmental DNA (or eDNA) monitoring. By filtering just a small amount of water from a creek, harbour, or ocean bay, scientists and community members alike can now uncover an entire world of biodiversity. From the tiniest bacteria to fish, sea sponges, and even dolphins.

eDNA works like a biological barcode scanner. Every living organism leaves behind microscopic traces of DNA, like genetic breadcrumbs, as they swim, feed, and move through their environment. By collecting and sequencing these traces, researchers can paint a rich, detailed picture of ecosystem health and species diversity without ever needing to catch or disturb a single creature.

Thanks to this incredible technology, Parsley Bay is now home to one of the world’s longest-running marine eDNA monitoring programs. Hundreds of species have been detected, and the data is freely available for anyone to explore. And now, interest in using these kits has exploded, with community groups, schools, and nature lovers all eager to get involved.

In the article that follows, Dr DiBattista offers a fascinating overview of how eDNA works, what we’ve already discovered in Sydney’s coastal waters, and how this technology is transforming conservation, education, and our everyday connection to the ocean.

A brief primer on a new biological monitoring tool based around DNA sequencing technologies and environmental DNA (or eDNA) that we can now use to document biodiversity in our surroundings.

Dr Joseph DiBattista, Griffith University

eDNA can be thought of as genetic “breadcrumbs” left behind in the environment that can identify every living thing, from microbes to mammals, thus fixing a more holistic lens on ecosystem health and function. Inside the cells of organisms lies a genetic code, and individual plants and animals shed tens of thousands of these cells into our oceans each day as they go about their business.

Capturing these breadcrumbs is as easy as filtering some of the seawater sampled at a coastal or marine site of particular interest, or freshwater from a large river or small creek, extracting the DNA in the filtrate, sequencing that DNA, and then assigning these DNA barcodes to specific species, akin to a barcode on supermarket items that can identify your snack purchases. These barcodes are small segments of DNA distinguished by the order and composition of As, Ts, Cs, and Gs. For example, one of the common fishes observed in Parsley Bay is Luderick (Girella tricuspidata), whose unique DNA barcode at the eDNA assay that we are using is: CTGGCCTTAAACATTGATGGCACGATACAACCGCCATCCGCCTGGAAACTACGAGCACCAGCTTGAAACCCAAAGGACTTGGCGGTGCTTTAGATCCAC. This DNA barcode is very different from that of any other fish, including the four other, closely related, Australian species in the Girella genus, some of which are similar in appearance.

We recently published a scientific paper in the journal of Environmental Research that highlights the biodiversity information that can be gained through what we refer to as tree of life (ToL) metabarcoding based on the sampling of seawater, isolation of eDNA in each sample, and running of >10 genetic tests for things like marine mammals, fish, molluscs, echinoderms, sponges, aquatic plants, and bacteria. In this case, in the winter of 2022, we were able to collect water samples at 34 sites around Sydney Harbour, as far west as Parramatta Weir, but also including sites in southern Sydney Harbour like Camp Cove, Parsley Bay, and adjacent Rose Bay (at the infamous dog beach). Here we found that the number of animal and plant species decreased as you moved away from the mouth of Sydney Harbour into the upper reaches of its tributaries. Interestingly, the differences between sites were not driven by one or a few keystone species, but instead it was based on the effects of many individual taxa coming and going into different parts of the harbour. See image.

Image: Graphical summary of eDNA results in Sydney Harbour.

We see this ToL-metabarcoding approach as an important tool to scientists and community groups alike interested in generating baseline biodiversity data in their neck of the woods (or local waters).

The research group of Dr Joseph DiBattista (Griffith University, formerly Australian Museum) continues to conduct monthly environmental DNA (eDNA) sampling at Parsley Bay, which started in August 2022 (2 seawater replicates filtered on each of the 34 sampling events). This work has revealed hundreds of species of fish, cnidarians (jellyfishes, temperate corals, and sea anemones), crustaceans (e.g., prawn and crabs), molluscs (e.g., clams, mussels, oysters, nudibranchs), sponges, sea squirts, and marine worms, as well thousands of species of photosynthetic organisms and bacteria based on the sequence data. These data consist of tens of thousands of permanent biodiversity records and make Parsley Bay the site of one of the longest running marine eDNA monitoring programs in the world. All the eDNA biodiversity data are publicly accessible on the Wilderlab Pty Ltd website. The eDNA work is funded in part by the Wettenhall Environment Trust and supported by the local conservation group Blue World and Woollahra Municipal Council. The program includes community engagement, local education initiatives, and complements citizen science contributions of underwater photos via the iNaturalist platform (Marine Biodiversity of Southern Sydney Harbour), which to date has generated 2649 animal and plant observations contributed by 107 citizen scientists, which make up 496 species identified by 369 iNaturalist users.

Leave a Reply

This site uses Akismet to reduce spam. Learn how your comment data is processed.

Discover more from National Parks Association of NSW

Subscribe now to keep reading and get access to the full archive.

Continue reading